1. INPUT HELP
2. OUTPUT HELP
3. CALCULATION OF THE PENALTY VALUE
If this is checked, Left (Forward) primer is designed as Eprimer.
One thiazole orange doubly labelled thymine nucleotide will appear in a designed Left primer as "Z".
Equivalent parameter of Set Left primer as Eprimer for the Right (Reverse) primer.
The sequence of a left primer to check and around which to design
right primers and optional internal probes. Must be a substring
of SEQUENCE_TEMPLATE.
If Set Left primer as Eprimer is checked, the sequence must contain "T", "Z" or their lower cases.
"Z" denotes the labelled nucleotide, thiazole orange doubly labelled thymine nucleotide, that must not appear more than one time in the sequence.
If "Z" is not contained, Edesign program will attempt to select appropriate position of "Z" substituting "T" in the sequence.
The sequence of a right primer to check and around which to
design left primers and optional internal probes. Must be a
substring of the reverse strand of SEQUENCE_TEMPLATE.
If Set Right primer as Eprimer is checked, equivalent restriction of Use my own Left primer is applied for the Right (Reverse) primer sequence.
If this is checked, Edesign will attempt to pick an internal probe or Eprobe to detect the PCR product.
This list specifies the direction of Internal Probe
If Use my own Internal Probe is inputted, the direction must be identical.
If this is checked, Internal Probe is designed as Eprobe.
One thiazole orange doubly labelled thymine nucleotide will appear in a designed Internal Probe as "Z".
The sequence of an internal probe to check and around which to
design left and right primers. Must be a substring of
SEQUENCE_TEMPLATE or the reverse strand of SEQUENCE_TEMPLATE.
Internal Probe Direction must be the same direction as the input sequence.
If Set Internal Probe as Eprobe is checked, the sequence must contain "T", "Z" or their lower cases.
"Z" denotes the labelled nucleotide, thiazole orange doubly labelled thymine nucleotide, that must not appear more than one time in the sequence.
If "Z" is not contained, Edesign program will attempt to select appropriate position of "Z" substituting "T" in the sequence.
If this is checked, Edesign will attempt to pick an internal probe to detect the target variant.
Target variant must be specified using "[", "]" and "/". Different variants are separated by "/".
Eg．[A/G] [A/T/G]
Not only single nucleotide variants
Eg．[ATTTA/TTTTG] [ATTTA/TA/C]
Insertion and Deletion
Eg．[GG/] [/TA/C]
The excluded nucleotides at the 5' and 3' end of the internal probe for setting the target variant. The default is 2 nucleotides. Generally an inner nucleotide is preferable for discriminating the variation.
This is to specify the modification position in an internal probe relative to the target variant.
If "[Far] Further than" is selected, the labelled nucleotide "Z" of Eprobe is designed far from the target variant.
"Z" will be designed more than the specified number of nucleotides (default: 2 nucleotides) away from the target variant.
With this design, the fluorescence of Eprobe will not be decreased by a mismatch base pair at the target variant position.
This design is often suitable for recognizing a peak in the derivative of the fluorescent melting curve.
If "[Near] Within" is selected, the labelled nucleotide "Z" of Eprobe is designed near or on the target variant.
"Z" will be designed within specified nucleotides (default: 1 nucleotide) from the target variant.
With this design, the fluorescence of Eprobe will be decreased by a mismatch base pair at the target variant position.
This design is suitable for recognizing the target variant by on-off detection of the fluorescence.
An identifier that is reproduced in the output to enable you to identify the chosen primers.
The sequence from which to choose primers. The sequence must be presented 5' -> 3' (i.e, in the normal way). In general, the nucleotides may be upper or lower case, but lower case letters are treated specifically if Lowercase masking is set. The entire sequence MUST be all on a single line. (In other words, the sequence cannot span several lines.)
A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so nucleotides of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form
<start>,<length>
where <start> is the index of the first nucleotide to consider, and <length> is the number of subsequent nucleotides in the primer-picking region.
If one or more targets are specified then a primer pair must flank at least one of them. A target might be a simple sequence repeat site (for example a CA repeat) or a single nucleotide polymorphism, or an exon for resequencing. The value should be a space-separated list of
<start>,<length>
pairs where <start> is the index of the first nucleotide of a target, and <length> is its length.
See also Inside Target Penalty, Outside Target Penalty.Primers and probes may not overlap any region specified in this tag. The associated value must be a space-separated list of
<start>,<length>
pairs where <start> is the index of the first nucleotide of the excluded region, and <length> is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.
This tag allows detailed specification of possible
locations of left and right primers in primer pairs.
The associated value must be a semicolon-separated list of
<left_start>,<left_length>,<right_start>,<right_length>
quadruples.
The left primer must be in the region specified by
<left_start>,<left_length> and
the right primer must be in the region specified by
<right_start>,<right_length>.
<left_start> and <left_length> specify the location of the left primer in terms of the index of
the first nucleotide in the region and the length of the region.
<right_start> and <right_length> specify the location of the right primer in analogous fashion.
As seen in the example below, if no integers are specified for a region then the location of the
corresponding primer is not constrained.
Example:
Pair OK Region List=100,50,300,50 ; 900,60,, ; ,,930,100
Specifies that there are three choices:
Left primer in the 50 bp region starting at position 100 AND right primer
in the 50 bp region starting at position 300
OR
Left primer in the 60 bp region starting at position 900 (and right primer anywhere)
OR
Right primer in the 100 bp region starting at position 930 (and left
primer anywhere)
If this list is not empty, then
the forward OR the reverse primer must overlap one of
these junction points by at least 3 Prime Junction Overlap
nucleotides at the 3' end and at least 5 Prime Junction Overlap
nucleotides at the 5' end.
In other words: The junction associated with a given position is the space immediately to the right
of that position in the template sequence on the strand given as input.
For example:
Overlap Junction List=20
# 1-based indexes
3 Prime Junction Overlap=4
template: atcataggccatgcctgagc^gctacgact
ok ...gagc^gcta-3' (left primer)
not ok ...gagc^gct-3' (left primer)
ok 3'-ctcg^cgat... (right pimer)
not ok 3'-tcg^cgat... (right primer)
5 Prime Junction Overlap=5
ok 5'-tgagc^gccg... (left primer)
not ok 5'-gagc^gccg... (left primer)
ok ...tgagc^gctac-5' (right primer)
not ok ...tgagc^gcta-5' (right primer)
Internal probes may not overlap any region specified by this tag. The associated value must be a space-separated list of
<start>,<length>
pairs, where <start> is the index of the first nucleotide of an excluded region, and <length> is its length. Often one would make Target regions excluded regions for internal probes.
Forces the 5' end of the left primer to be at the indicated position. Primers are also picked if they violate certain constraints. The default value indicates that the start of the left primer can be anywhere.
Forces the 3' end of the left primer to be at the indicated position. Primers are also picked if they violate certain constraints. The default value indicates that the end of the left primer can be anywhere.
Forces the 5' end of the right primer to be at the indicated position. Primers are also picked if they violate certain constraints. The default value indicates that the start of the right primer can be anywhere.
Forces the 3' end of the right primer to be at the indicated position. Primers are also picked if they violate certain constraints. The default value indicates that the end of the right primer can be anywhere.
The maximum number of primer (pairs) to return. Primer pairs returned are sorted by their "quality", in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.
The 3' end of the left OR the right primer must overlap one of the junctions in Overlap Junction List by this amount. See details in Overlap Junction List.
The 5' end of the left OR the right primer must overlap one of the junctions in Overlap Junction List by this amount. See details in Overlap Junction List.
The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form
<x>-<y>
where an <x>-<y> pair is a legal range of lengths for the
product. For example, if one wants PCR products to be between
100 to 150 nucleotides (inclusive) then one would set this parameter to
100-150. If one desires PCR products in either the range from
100 to 150 nucleotides or in the range from 200 to 250 nucleotides then one
would set this parameter to 100-150 200-250.
Edesign favors product-size ranges to the left side of the parameter string.
Edesign will return primer pairs in the first range
regardless the value of the objective function for pairs in subsequent ranges.
Only if there are an insufficient number of primers in the first
range will Edesign return primers in a subsequent range.
For those with primarily a computational background,
the PCR product size is the size (in base pairs)
of the DNA fragment that would be produced by the
PCR reaction on the given sequence template. This
would, of course, include the primers themselves.
Minimum, Optimum, and Maximum lengths (in nucleotides) of a primer oligo. Edesign will not pick primers shorter than Min or longer than Max, and with default arguments will attempt to pick primers close in size to Opt. Min cannot be smaller than 1. Max cannot be larger than 36. (This limit is governed by maximum oligo size for which melting-temperature calculations are valid.) Min cannot be greater than Max.
Equivalent parameter of Primer Size for the internal probe.
This section describes "penalty weights", which allow the user to modify the criteria that Edesign uses to select the "best" primers. There are two classes of weights: for some parameters there is a 'Lt' (less than) and a 'Gt' (greater than) weight. These are the weights that Edesign uses when the value is less or greater than (respectively) the specified optimum. The following parameters have both 'Lt' and 'Gt' weights:
* Product SizeThe Inside Target Penalty and Outside Target Penalty are similar, except that since they relate to position they do not lend themselves to the 'Lt' and 'Gt' nomenclature.
For the remaining parameters the optimum is understood and the actual value can only vary in one direction from the optimum:
* Primer Self ComplementarityThe following govern the weight given to various parameters of primer pairs.
* Tm differenceThe following govern the weight given to various parameters of primer-internal probe pairs.
* Primer-Internal Probe Complementarity(In case of genotyping)
The following govern the weight given to parameter for genotyping.
(In case of use of Eprobe/Eprimer)
The following govern the weight given to parameter for the labelling.
Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer.
Equivalent parameter of Primer GC% for the internal probe.
Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer. (This parameter has no effect on the internal probe if one is requested.)
The maximum number of Gs or Cs allowed in the last five 3' nucleotides of a left or right primer.
Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Edesign will not pick oligos with temperatures smaller than Min or larger than Max, and with default conditions will try to pick primers with melting temperatures close to Opt.
For Eprimer, the effect of the dye moieties is considered as described in the paper [Kimura,Y., Hanami,T., Tanaka,Y., de Hoon,M.J.L., Soma,T., Harbers,M., Lezhava,A., Hayashizaki,Y. and Usui,K. Effect of Thiazole Orange Doubly Labelled Thymidine on DNA Duplex Formation. Biochemistry, 51, 6056-6067 (2012)].
Equivalent parameter of Primer Tm for the internal probe.
For Eprobe, the effect of the dye moieties is considered as described in the paper [Kimura,Y., Hanami,T., Tanaka,Y., de Hoon,M.J.L., Soma,T., Harbers,M., Lezhava,A., Hayashizaki,Y. and Usui,K. Effect of Thiazole Orange Doubly Labelled Thymidine on DNA Duplex Formation. Biochemistry, 51, 6056-6067 (2012)].
Minimum melting temperature (Celsius) for an internal probe against the Target Variant sequence. I case of genotyping by Internal Probe, Edesign will calculate the melting temperatures of internal probes against Target Variant sequence and NOT pick internal probes smaller than this parameter.
Penalty weight for the difference of the melting temperatures of an internal probe caused by the Target Variant. This parameter is used in the genotyping mode. The larger the difference, the easier it is to discriminate a mismatch case from a perfect match case. If this weight is larger than 0, higher penalty is given to smaller TM difference.
Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.
Penalty weight for the TM difference between the left primer and the right primer.
The minimum allowed melting temperature of the amplicon. Please see the documentation on PRIMER_PRODUCT_MAX_TM for details.
Specifies details of melting temperature calculation.
Edesign uses the table of thermodynamic values and the method for melting temperature
calculation suggested in the paper [SantaLucia JR (1998) "A unified
view of polymer, dumbbell and oligonucleotide DNA nearest-neighbor
thermodynamics", Proc Natl Acad Sci 95:1460-65
http://dx.doi.org/10.1073/pnas.95.4.1460].
Use tag Salt Correction Formula, to specify the salt correction
method for melting temperature calculation.
Example of calculating the melting temperature of an oligo if
Table of thermodynamic parameters=1 and Salt Correction Formula=1
recommended values:
primer=CGTGACGTGACGGACT
Using default salt and DNA concentrations we have
Tm = deltaH/(deltaS + R*ln(C/4))
where R is the gas constant (1.987 cal/K mol) and C is the DNA concentration.
deltaH(predicted) =
= dH(CG) + dH(GT) + dH(TG) + .. + dH(CT) +
+ dH(init.w.term.GC) + dH(init.w.term.AT) =
= -10.6 + (-8.4) + (-8.5) + .. + (-7.8) + 0.1 + 2.3 =
= -128.8 kcal/mol
where 'init.w.term GC' and 'init.w.term AT' are two initiation parameters for duplex formation: 'initiation with terminal GC' and 'initiation with terminal AT'
deltaS(predicted) =
= dS(CG) + dS(GT) + dS(TG) + .. + dS(CT) +
+ dS(init.w.term.GC) + dS(init.w.term.AT) =
= -27.2 + (-22.4) + (-22.7) + .. + (-21.0) + (-2.8) + 4.1 =
= -345.2 cal/k*mol
deltaS(salt corrected) =
= deltaS(predicted) + 0.368*15(NN pairs)*ln(0.05M monovalent cations) =
= -361.736
Tm = -128.800/(-361.736+1.987*ln((5*10^(-8))/4)) =
= 323.704 K
Tm(C) = 323.704 - 273.15 = 50.554 C
The millimolar (mM) concentration of monovalent salt cations (usually KCl) in the PCR. Edesign uses this argument to calculate primer/probe melting temperatures. Use tag Concentration of Divalent Cations and PRIMER_INTERNAL_SALT_DIVALENT to specify the concentrations of divalent cations (in which case you should also set tag Concentration of dNTPs to a reasonable value).
The millimolar concentration of divalent salt cations (usually MgCl2) in
the PCR. (New in v. 1.1.0, added by Maido Remm and Triinu Koressaar)
Edesign converts the concentration of divalent cations to the concentration
of monovalent cations using the formula suggested in the paper [Ahsen von N,
Wittwer CT, Schutz E (2001) "Oligonucleotide Melting Temperatures under PCR
Conditions: Nearest-Neighbor Corrections for Mg2+, Deoxynucleotide Triphosphate,
and Dimethyl Sulfoxide Concentrations with Comparison to Alternative Empirical
Formulas", Clinical Chemistry 47:1956-61 http://www.clinchem.org/cgi/content/full/47/11/1956].
[Monovalent cations] = [Monovalent cations] + 120*(([divalent cations] - [dNTP])^0.5)
In addition, if the specified concentration of dNTPs (Concentration of dNTPs) is larger than the concentration of divalent cations (Concentration of Divalent Cations) then the effect of the divalent cations is not considered. The concentration of dNTPs is considered in the formula above because some magnesium is bound by the dNTPs. The adjusted concentration of monovalent cations is used in the calculation of primer/probe melting temperature, PCR product melting temperature, and the stability of secondary structures (when PRIMER_THERMODYNAMIC_ALIGNMENT is 1). If Concentration of Divalent Cations > 0.0, be sure to set tag Concentration of dNTPs to specify the concentration of dNTPs.
The millimolar concentration of the sum of all deoxyribonucleotide triphosphates (dNTP). A reaction mix containing 0.2 mM ATP, 0.2 mM CTP, 0.2 mM GTP and 0.2 mM TTP would have a Concentration of dNTPs=0.8. This argument is considered for primer/probe primer melting temperatures, for PCR product melting temperature, or for secondary structure calculations only if Concentration of Divalent Cations is > 0.0. See Concentration of Divalent Cations.
Specifies the salt correction formula for the melting temperature
calculation.
In Edesign, only "SantaLucia 1998" is available, the salt correction formula in the paper [SantaLucia JR (1998)
"A unified view of polymer, dumbbell and oligonucleotide DNA nearest-neighbor thermodynamics",
Proc Natl Acad Sci 95:1460-65 http://dx.doi.org/10.1073/pnas.95.4.1460].
Edesign considers the values of the tags Concentration of Divalent Cations,
PRIMER_INTERNAL_SALT_DIVALENT,
Concentration of dNTPs, and
PRIMER_INTERNAL_DNTP_CONC.
A value using the nanomolar (nM) concentration of each annealing primer over the course the PCR.
Edesign uses this argument to estimate primer melting temperatures.
This parameter corresponds to 'c' in the equation (ii)
of the paper [SantaLucia (1998) A unified view of polymer, dumbbell,
and oligonucleotide DNA nearest-neighbor thermodynamics.
Proc Natl Acad Sci 95:1460-1465
http://www.pnas.org/content/95/4/1460.full.pdf+html],
where a suitable value (for a lower initial concentration of template)
is "empirically determined".
The default (50nM) works well with the standard
protocol used at the Whitehead/MIT Center for Genome
Research--0.5 microliters of 20 micromolar concentration for each
primer in a 20 microliter reaction with 10 nanograms
template, 0.025 units/microliter Taq polymerase in 0.1 mM each
dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
cycles with an annealing temperature of 56 degrees Celsius.
The value of this parameter is less than the actual
concentration of primers in the initial reaction mix because it is the
concentration of annealing primers, which in turn depends on the
amount of template (including PCR product) in a given cycle.
This concentration increases a great deal during a PCR;
fortunately PCR seems quite robust for a variety of primer melting
temperatures.
See ADVICE FOR PICKING PRIMERS.
Equivalent parameter of Annealing Primer Concentration for the internal probe.
If this is checked (the associated value = 1), then Edesign will use thermodynamic models to calculate the propensity of oligos to form hairpins and dimers.
This parameter describes the tendency of a primer to bind to
itself (interfering with target sequence binding). It will score
ANY binding occurring within the entire primer sequence.
It is the maximum allowable local alignment score when testing
a single primer for (local) self-complementarity and the
maximum allowable local alignment score when testing for
complementarity between left and right primers. Local
self-complementarity is taken to predict the tendency of primers
to anneal to each other without necessarily causing self-priming
in the PCR. The scoring system gives 1.00 for complementary
bases, -0.25 for a match of any base (or N) with an N, -1.00 for
a mismatch, and -2.00 for a gap. Only single-base-pair gaps are
allowed. For example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.
The same as OLD: Primer Max Self Complementarity but all calculations are based on thermodynamical approach. The melting temperature of the most stable structure is calculated. To calculate secondary structures nearest-neighbor parameters for perfect matches, single internal mismatches, terminal mismatches, dangling ends have been used. Also parameters for increments for length dependence of bulge and internal loops have been used. This parameter is calculated only if PRIMER_THERMODYNAMIC_ALIGNMENT=1. The by default value is 10 degrees lower than the default value of PRIMER_MIN_TM.
Equivalent parameter of OLD: Primer Max Self Complementarity for the internal probe.
Equivalent parameter of TH: Primer Max Self Complementarity for the internal probe.
This parameter describes the tendency of the left primer to bind to the right primer or the right primer to bind to the left primer. It is similar to OLD: Primer Max Self Complementarity.
Edesign also calculates the complementarity of the left primer to the internal probe and the right primer to the internal probe.
This parameter describes the tendency of the left primer to bind to the right primer or the right primer bind to the left primer. It is similar to TH: Primer Max Self Complementarity.
Edesign also calculates the complementarity of the left primer to the internal probe and the right primer to the internal probe.
Penalty weight for the individual primer self-binding value as in OLD: Primer Max Self Complementarity.
Penalty weight for the individual primer self-binding value as in TH: Primer Max Self Complementarity.
Equivalent parameter of (Weight) OLD: Primer Self Complementarity for the internal probe.
Equivalent parameter of (Weight) TH: Primer Self Complementarity for the internal probe.
Penalty weight for the binding value of the primer pair as in OLD: Pair Max Any Complementarity.
Penalty weight for the binding value of the primer pair as in TH: Pair Max Any Complementarity.
Edesign calculates the binding of the primer 3'-END to an identical primer
and scores the best binding it can find. This is critical for
primer quality because if primers use themselves as a target
and amplify a short piece (forming a primer-dimer), these primers
are then unable to bind and amplify the target sequence.
This parameter is the maximum allowable 3'-anchored global
alignment score when testing a single primer for
self-complementarity, and the maximum allowable 3'-anchored
global alignment score when testing for complementarity between
left and right primers. The 3'-anchored global alignment score
is taken to predict the likelihood of PCR-priming primer-dimers,
for example
5' ATGCCCTAGCTTCCGGATG 3'
||| |||||
3' AAGTCCTACATTTAGCCTAGT 5'
or
5` AGGCTATGGGCCTCGCGA 3'
||||||
3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Edesign assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter (OLD: Primer Max Self Complementarity) because the score of a local alignment will always be at least as great as the score of a global alignment.
Same as OLD: Primer Max 3' Self Complementarity but is based on thermodynamical approach - the stability of structure is analyzed. The value of tag is expressed as melting temperature. See TH: Primer Max Self Complementarity for details.
This parameter is meaningless when internal probes have 3' end modification to prevent extension for hybridization-based detection. We recommend that this parameter is set at least as high as OLD: Internal Probe Max Self Complementarity.
Same as OLD: Internal Probe Max 3' End Self Complementarity but for calculating the score (melting temperature of structure) thermodynamical approach is used.
Edesign tries to bind the 3'-END of the left primer to the right primer or the 3'-END of the right primer to the left primer, and scores the best binding it can find. It is similar to OLD: Primer Max 3' Self Complementarity.
Edesign also calculates the complementarity of the 3'-END of the left primer to the internal probe and the 3'-END of the right primer to the internal probe.
Same as OLD: Pair Max 3' Complementarity but for calculating the score (melting temperature of structure) thermodynamical approach is used.
Edesign also calculates the complementarity of the 3'-END of the left primer to the internal probe and the 3'-END of the right primer to the internal probe.
Penalty weight for the individual primer self-binding value as in OLD: Primer Max 3' Self Complementarity.
Penalty weight for the individual primer self-binding value as in TH: Max 3' Self Complementarity
Equivalent parameter of (Weight) OLD: Primer 3' Self Complementarity for the internal probe.
Equivalent parameter of (Weight) TH: Primer 3' Self Complementarity for the internal probe.
Penalty weight for the binding value of the primer pair as in OLD: Pair Max 3' Complementarity.
Penalty weight for the binding value of the primer pair as in TH: Pair Max 3' Complementarity.
This is the most stable monomer structure of internal probe calculated by thermodynamic approach. The hairpin loops, bulge loops, internal loops, internal single mismatches, dangling ends, terminal mismatches have been considered. This parameter is calculated only if PRIMER_THERMODYNAMIC_ALIGNMENT=1. The by default value is 10 degrees lower than the default value of PRIMER_MIN_TM.
It is recommended to use low value for Eprimer.
The most stable monomer structure of internal probe calculated by thermodynamic approach. See TH: Primer Max Hairpin for details.
It is recommended to use low value for Eprobe.
Penalty weight for the individual primer hairpin structure value as in TH: Primer Max Hairpin.
Penalty weight for the most stable primer hairpin structure value as in TH: Internal Probe Max Hairpin.
The maximum stability for the last five 3' nucleotides of a left or
right primer. Bigger numbers mean more stable 3' ends. The
value is the maximum delta G (kcal/mol) for duplex disruption for
the five 3' nucleotides as calculated using the nearest-neighbor
parameter values specified by the option of Table of thermodynamic parameters
For example, if the table of thermodynamic parameters suggested
by SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 is used the deltaG
values for the most stable and for the most labile 5mer duplex
are 6.86 kcal/mol (GCGCG) and 0.86 kcal/mol (TATAT) respectively.
Penalty weight for the calculated maximum stability for the last five 3' nucleotides of a left or right primer.
Maximum number of unknown nucleotides (N) allowable in any primer.
Equivalent parameter of Primer Max #N's accepted for the internal probe.
Penalty weight for the number of Ns in the primer.
Equivalent parameter of (Weight) Primer #N's for the internal probe.
The maximum allowable length of a mononucleotide repeat, for example AAAAAA.
Equivalent parameter of Primer Max Poly-X for the internal probe.
When returning multiple primer pairs,
the minimum number of base pairs between the 3' ends of
any two left primers.
Primers with 3' ends at positions e.g. 30 and 31 in the template
sequence have a three-prime distance of 1.
In addition to positive values, the values -1 and 0
are acceptable and have special interpretations:
-1 indicates that a given left primer can appear in
multiple primer pairs returned by Edesign.
This is the default behavior.
0 indicates that a left primer is acceptable if it
was not already used.
In other words, two left primers are allowed to
have the same 3' position provided their 5' positions differ.
For n > 0:
A left primer is acceptable if:
NOT(3' end of left primer closer than n to the 3' end of a previously
used left primer)
Analogous to 3' End Distance Between Left Primers,
but for right primers.
If true, use primer provided in Use my own Left primer, Use my own Right primer, or Use my own Internal Probe even if it violates specific constraints.
This option allows for intelligent design of primers in sequence in
which masked regions (for example repeat-masked regions) are
lower-cased.
A value of 1 directs Edesign to reject primers overlapping
a lowercase nucleotide exactly at the 3' end.
This property relies on the assumption that masked features
(e.g. repeats) can partly overlap primer, but they cannot overlap
the 3'-end of the primer. In other words, lowercase nucleotides at
other positions in the primer are accepted, assuming that the
masked features do not influence the primer performance if they
do not overlap the 3'-end of primer.
If this flag is 1 (non-0), produce PRIMER_LEFT_EXPLAIN, PRIMER_RIGHT_EXPLAIN, PRIMER_INTERNAL_EXPLAIN and/or PRIMER_PAIR_EXPLAIN output tags as appropriate. These output tags are intended to provide information on the number of oligos and primer pairs that Edesign examined and counts of the number discarded for various reasons. If -format_output is set similar information is produced in the user-oriented output.
This parameter provides a quick-and-dirty way to get Edesign to
accept IUB / IUPAC codes for ambiguous nucleotides (i.e. by changing
all unrecognized nucleotides to N). If you wish to include an
ambiguous nucleotide in an oligo, you must set Max #N's accepted to a
1 (non-0) value.
Perhaps '-' and '* ' should be squeezed out rather than changed
to 'N', but currently they simply get converted to N's. The authors
invite user comments.
This parameter is the index of the first nucleotide in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing, set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.)
The maximum allowed similarity of a primer to ectopic sites in the template. A negative value means do not check. The scoring system is the same as used for Primer Max Library Mispriming, except that an ambiguity code in the template is never treated as a consensus (see Treat ambiguity codes in libraries as consensus
Similar to OLD: Primer Max Template Mispriming but assesses alternative binding sites in the template using thermodynamic models. This parameter specifies the maximum allowed melting temperature of a primer at an "ectopic" site within the template sequence.
The maximum allowed similarity of an internal probe to ectopic sites in the template. A negative value means do not check. The scoring system is the same as used for Primer Max Library Mispriming, except that an ambiguity code in the template is never treated as a consensus (see Treat ambiguity codes in libraries as consensus
Similar to OLD: Internal Probe Max Template Mishyb but assesses alternative binding sites in the template using thermodynamic models. This parameter specifies the maximum allowed melting temperature of an internal probe at an "ectopic" site within the template sequence.
The maximum allowed summed similarity of both primers to ectopic sites in the template. A negative value means do not check. The scoring system is the same as used for Pair Max Library Mispriming, except that an ambiguity code in the template is never treated as a consensus (see Treat ambiguity codes in libraries as consensus). Edesign does not check the similarity of internal probes to locations outside of the amplicon.
The maximum allowed summed melting temperatures of both primers at ectopic sites within the template (with the two primers in an orientation that would allow PCR amplification.) The melting temperatures are calculated as for TH: Primer Max Template Mispriming.
Penalty weight for a single primer binding to the template sequence.
Penalty weight for a single primer binding to the template sequence (thermodynamic approach).
Penalty weight for an internal probe binding to the template sequence.
Penalty weight for an internal probe binding to the template sequence (thermodynamic approach).
Penalty weight for a primer pair binding to the template sequence.
Penalty weight for a primer pair binding to the template sequence (thermodynamic approach).
The name of a file containing a nucleotide sequence library of
sequences to avoid amplifying (for example repetitive sequences, or
possibly the sequences of genes in a gene family that should
not be amplified.) The file must be in FASTA format.
If this parameter is specified then Edesign locally
aligns each candidate primer against each library sequence and
rejects those primers for which the local alignment score times a
specified weight (see below) exceeds Primer Max Library Mispriming.
Each sequence entry in the FASTA-format file must begin with an
"id line" that starts with '>'. The contents of the id line is
"slightly restricted" in that Edesign parses everything after any
optional asterisk ('*') as a floating point number to use as the
weight mentioned above. If the id line contains no asterisk then
the weight defaults to 1.0. (The maximum value of the weight is 100.0.)
The alignment scoring system used is
the same as for calculating complementarity among oligos (e.g.
Max Self Complementarity), except for the handling of IUB/IUPAC ambiguity
codes (discussed below).
The remainder of an entry contains the sequence as lines
following the id line up until a line starting with '>' or
the end of the file. Whitespace and newlines are ignored.
Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' and
IUB/IUPAC 'ambiguity' codes ('R, 'Y', 'K', 'M', 'S', 'W',
'N', including lower case) are retained. For technical
reasons the length of the sequence must be >= 3. Of course,
sequences of length < 10 or so are probably useless, but
will be accepted without complaint.
WARNING: always set Treat ambiguity codes in libraries as consensus=0
if any sequence in the library contains strings of
'N's: NNNNNNNNNNNNNNNNNNNN.
There are no restrictions on line length.
An empty value for this parameter indicates that no repeat
library should be used and "turns off" the use of a
previously specified library.
The contents of the libraries can be viewed at the following links:
If set to 1, treat ambiguity codes as if they were consensus codes when matching oligos to mispriming or mishyb libraries. For example, if this flag is set, then a C in an oligo will be scored as a perfect match to an S in a library sequence, as will a G in the oligo. More importantly, though, any nucleotide in an oligo will be scored as a perfect match to an N in the library. This is very bad if the library contains strings of Ns, as no oligo will be legal (and it will take a long time to find this out). So unless you know for sure that your library does not have runs of Ns (or Xs), then set this flag to 0.
The maximum allowed weighted similarity with any sequence in Mispriming Library.
Similar to Max Library Mispriming except that this parameter applies to the similarity of candidate internal probes to the library specified in Internal Probe Mishyb Library<.
The maximum allowed sum of similarities of a primer pair (one similarity for each primer) with any single sequence in Mispriming Library. Library sequence weights are not used in computing the sum of similarities.
Penalty weight for a single primer binding to any single sequence in Mispriming Library.
Penalty weight for an internal probe binding to any single sequence in Mispriming Library.
Penalty weight for a primer pair binding to any single sequence in Mispriming Library.
Penalty weight factor for the sum of the left and the right primer added
to the pair penalty. Setting this value below 1.0 will increase
running time.
As (Weight) Primer Penalty Weight or the per-primer
penalties it multiplies become lower with respect to various
pair penalties (for example (Weight) Product Size Lt
(Weight) Product Size Gt
(Weight) Tm Difference, etc.) the running time of the
search for primer pairs is likely to grow substantially. The
reason is that the search algorithm must calculate the penalty
for more primer pairs.
Penalty weight factor for the internal probe added to the pair penalty.
Non-default values are valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Edesign to include overlap with the target as a term in the objective function.
Non-default values are valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and does not overlap the target, then multiply this value times the number of nucleotide positions from the 3' end to the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Edesign to include nearness to the target as a term in the objective function.
Penalty weight for the primer which do not overlap the target.
The excluded nucleotides at the 5' end of the primer for modification. For Eprimer, the default is 2 nucleotides.
The excluded nucleotides at the 3' end of the primer for modification. For Eprimer, the default is 1 nucleotide.
The excluded nucleotides at the 5' end of the internal probe for modification. For Eprobe, the default is 2 nucleotides.
The excluded nucleotides at the 3' end of the internal probe for modification.
For Eprobe, the default is 2 nucleotides.
Penalty weight for modification positions next to the excluded region.
In case those positions are possible for modification but not a best option.
For Eprobe, the first and second nucleotide from terminal end are not preferable for labelling.
By default the excluded nucleotides for labelling are two. But labelling the third nucleotide sometimes reduces fluorescence a little.
This penalty weight is applied for the third nucleotide in this case as next to the excluded region to avoid labelling the third nucleotide.
The position of the 5' nucleotide of the primer.
For a Left Primer or an Internal Probe (Forward) this position is the position
of the leftmost nucleotide.
For a Right primer or an Internal Probe (Reverse) it is the position of the rightmost nucleotide.
The length of the primer or probe.
The melting temperature of the primer or probe.
The melting temperature of the primer or probe against the target variant sequence.
The percentage of G or C nucleotides in the primer or probe.
The self-complementarity score of the primer or probe (taken as a measure of its tendency to anneal to itself or form secondary structures).
The 3' self-complementarity of the primer or probe (taken as a measure of its tendency to form a primer-dimer with itself).
The calculated value of the melting temperature of the most stable hairpin structure of the primer or probe.
The similarity to the specified Mispriming or Mishyb library.
The sequence of the selected primer or probe, always 5' to 3' so the right primer is on the opposite strand from the one supplied in the source input. (The right primer sequence is the sequence you would want synthesized in a primer order.) "Z" denotes the labelled nucleotide, thiazole orange doubly labelled thymine nucleotide.
In essence, the penalty values define what is the best primer
pair.
The calculation of penalty values
takes into consideration penalty weights, which allow
one to fine-tune the selection of primers to specific needs.
This section will explain the selection process of primers by
Edesign. In general the selection is a multi-step process:
In the first step, Edesign evaluates every primer that
can be picked in the region of interest, possibly subject to
constraints due to target regions, product size ranges, and
so forth, that might preclude the use of primers in the
eventually selected primer pairs. In this pass the hard
limits are tested like PRIMER_MAX_GC or PRIMER_MIN_TM. Primers
with a GC lower than PRIMER_MAX_GC or a Tm higher than
PRIMER_MIN_TM are memorized, the primers which fail in one of
these tests are excluded. Edesign can be forced to use primers
failing to pass this test by setting Pick anyway to one
(only available for primers provided by the user).
In the second step, Edesign calculates a penalty for each
primer. This penalty is the only score by which Edesign
evaluates the primers and the internal probe.
Edesign enhances calculation of the penalty for the internal probe.
Edesign tries to select pairs with the lowest penalty which still fulfill all necessary requirements like non-redundancy or product size limits.